Simon Coetzee
06/23/2023
This work, “Searching NGS File Formats”, is a derivative of “Intro to Shell” by hbctraining, used under CC BY and is a derivative of part of “Applied Computational Genomics Course at UU” by quinlan-lab, and “bedtools Tutorial” by quinlan-lab used under CC BY-SA. “Searching NGS File Formats and Genome Arithmetic” is licensed under CC BY by Simon Coetzee.
Search for characters or patterns in a text file using the grep command
Write to and append a file using output redirection
Search for characters or patterns in a text file using the grep command
Write to and append a file using output redirection
Use the pipe |
character to chain together commands
grep
is a command-line utility for searching plain-text data sets for lines
that match a regular expression. Its name comes from the ed
command g/re/p
(globally search for a regular expression and print matching lines),
which has the same effect
grep
syntax looks like
grep search_term filename
Get some FASTQ data:
$ wget https://cloud.coetzee.me/s/zsYsQEyjk84aCYt/download/data.tar.gz
$ tar xvf data.tar.gz
$ cp ~/data/*.fq ~/lecture5
$ ls ~/lecture5
Mov10_oe_1.subset.fq Mov10_oe_2.subset.fq Mov10_oe_3.subset.fq
$ head ~/lecture4/Mov10_oe_1.subset.fq
@HWI-ST330:304:H045HADXX:1:1101:1162:2055
NAGAACTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTT
+
#1=DDFFFHHHGHIJJJJIJJJGEGGAFGBHHEHGFBFFDEDECDDA==CB@BDDDDD?;B-<CBDDD>BBBBDDB5<@DDDCDDB@-9ACDDDDB?B<?
@HWI-ST330:304:H045HADXX:2:2111:20110:84312
GTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAG
+
@@<FFFFDFFH>DEGFEGIJGJIJD9;CFCG;@;9?DDCD8AHGEF@84ADB?CD>3@CAACBBBDD@@@??90))5055(22-95<-5(:<ACBB@?8?
@HWI-ST330:304:H045HADXX:1:1214:9417:35291
CTCCAGACTCCGATCGTACAGCTTGAACTTCACATCTGAGGGCAGCAACGAGACCCCACGGGAGGCCACAGGAAAAAGCATGGGCCATAGCACCCAGCGC
Let's say we consider “bad” reads from our file as those that contain 10
consecutive Ns. We can grep
for that.
$ grep NNNNNNNNNN Mov10_oe_1.subset.fq
This will return many lines of text!
But only the actual read, what if we wanted to see the whole record, all four lines?
To see what command line arguments we can use to modify grep
s behavior, we can enter the following in your open bash shell
$ man grep
GREP(1) User Commands GREP(1)
NAME
grep, egrep, fgrep, rgrep - print lines that match
patterns
SYNOPSIS
grep [OPTION...] PATTERNS [FILE...]
grep [OPTION...] -e PATTERNS ... [FILE...]
grep [OPTION...] -f PATTERN_FILE ... [FILE...]
DESCRIPTION
grep searches for PATTERNS in each FILE. PATTERNS
Given that we are looking for four lines (one record), we want the line before the read, and two lines after the read.
-A NUM, --after-context=NUM
Print NUM lines of trailing context after
matching lines. Places a line containing a
group separator (--) between contiguous
groups of matches. With the -o or
--only-matching option, this has no effect
and a warning is given.
-B NUM, --before-context=NUM
Print NUM lines of leading context before
matching lines. Places a line containing a
group separator (--) between contiguous
groups of matches. With the -o or
--only-matching option, this has no effect
The -B
and -A
arguments for grep
will be useful to return the matched line plus one before -B 1
and two lines after -A 2
.
The -B
and -A
arguments for grep
will be useful to return the matched line plus one before -B 1
and two lines after -A 2
.
$ grep -B 1 -A 2 NNNNNNNNNN Mov10_oe_1.subset.fq
@HWI-ST330:304:H045HADXX:1:1101:1111:61397
CACTTGTAAGGGCAGGCCCCCTTCACCCTCCCGCTCCTGGGGGANNNNNNNNNNANNNCGAGGCCCTGGGGTAGAGGGNNNNNNNNNNNNNNGATCTTGG
+
@?@DDDDDDHHH?GH:?FCBGGB@C?DBEGIIIIAEF;FCGGI#########################################################
--
@HWI-ST330:304:H045HADXX:1:1101:1106:89824
CACAAATCGGCTCAGGAGGCTTGTAGAAAAGCTCAGCTTGACANNNNNNNNNNNNNNNNNGNGNACGAAACNNNNGNNNNNNNNNNNNNNNNNNNGTTGG
+
?@@DDDDDB1@?:E?;3A:1?9?E9?<?DGCDGBBDBF@;8DF#########################################################
--
The -B
and -A
arguments for grep
will be useful to return the matched line
plus one before -B 1
and two lines after -A 2
. The argument
--no-group-separator
will make sure that the --
group separator lines
between results are removed, so the output appears in the same format as the input.
$ grep -B 1 -A 2 --no-group-separator NNNNNNNNNN Mov10_oe_1.subset.fq
@HWI-ST330:304:H045HADXX:1:1101:1111:61397
CACTTGTAAGGGCAGGCCCCCTTCACCCTCCCGCTCCTGGGGGANNNNNNNNNNANNNCGAGGCCCTGGGGTAGAGGGNNNNNNNNNNNNNNGATCTTGG
+
@?@DDDDDDHHH?GH:?FCBGGB@C?DBEGIIIIAEF;FCGGI#########################################################
@HWI-ST330:304:H045HADXX:1:1101:1106:89824
CACAAATCGGCTCAGGAGGCTTGTAGAAAAGCTCAGCTTGACANNNNNNNNNNNNNNNNNGNGNACGAAACNNNNGNNNNNNNNNNNNNNNNNNNGTTGG
+
?@@DDDDDB1@?:E?;3A:1?9?E9?<?DGCDGBBDBF@;8DF#########################################################
Another helpful argument for grep
is the -v
argument:
-v, --invert-match
Invert the sense of matching, to select non-
matching lines.
basically returning everything that does not match the pattern.
we can examine a sample file from /data
directory.
$ cp ~/data/sample_sheet.txt ~/lecture5
$ cd ~/lecture5
$ cat sample_sheet.txt
sample treatment
AR.1 vehicle
AR.2 vehicle
AR.3 vehicle
AR.DHT.1 DHT
AR.DHT.2 DHT
AR.DHT.3 DHT
we can see the metadata file for a hypothetical chipseq experiment.
If we don't want to see the vehicle samples we can use the -v
argument like this:
$ grep -v vehicle sample_sheet.txt
sample treatment
AR.DHT.1 DHT
AR.DHT.2 DHT
AR.DHT.3 DHT
It returns all the lines in the file except the lines that contain vehicle.
>
We can use this to, instead of writing the output of a command to a terminal where we see it, write to a file to store that output.
For example, we can store all the sequences that contain NNNNNNNNNN
to a new file called bad_reads.fq
$ grep -B 1 -A 2 --no-group-separator NNNNNNNNNN Mov10_oe_1.subset.fq > bad_reads.fq
A new file is created called bad_reads.fq
, and nothing is displayed on the screen.
We can confirm the file was created by entering:
$ ls -l
>>
If we were to execute the previous command on a new file Mov10_oe_2.subset.fq
$ grep -B 1 -A 2 --no-group-separator NNNNNNNNNN Mov10_oe_2.subset.fq > bad_reads.fq
It would overwrite the results, replacing them with new reads.
However, if we would like to append the bad reads from the new file to the end of the bad_reads.fq
file, we would use the >>
command instead.
$ grep -B 1 -A 2 --no-group-separator NNNNNNNNNN Mov10_oe_2.subset.fq >> bad_reads.fq
$ ls -l bad_reads.fq
IMO one of the coolest parts about the *nix environment.
|
(pipe).We can pipe the output of a command to less
for example to be able to scroll through it at our leisure rather than watching it whiz by.
$ grep -B 1 -A 2 NNNNNNNNNN Mov10_oe_1.subset.fq | less
Or if we only want to see the first few lines of output, we could pipe it into head
$ grep -B 1 -A 2 NNNNNNNNNN Mov10_oe_1.subset.fq | head -n 8
Or maybe we only want to know how many lines from a file match our pattern. We could use the command wc
.
wc
stands for word count, and can count the number of words, lines, and characters in a piece of text given to it.
the argument -l
indicates to count only the lines.
see man wc
like we did with grep before to see more options.
$ grep NNNNNNNNNN Mov10_oe_1.subset.fq | wc -l
Lets look at a gene annotation file like the GTF we saw before
We will download a sample gtf file from gencode:
$ cd ~
$ wget https://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_39/gencode.v39.annotation.gtf.gz
$ gunzip gencode.v39.annotation.gtf.gz
$ mv ~/gencode.v39.annotation.gtf ~/lecture5
$ cd ~/lecture5
$ less gencode.v39.annotation.gtf
##description: evidence-based annotation of the human genome (GRCh38), version 39 (Ensembl 105)
##provider: GENCODE
##contact: gencode-help@ebi.ac.uk
##format: gtf
##date: 2021-09-02
chr1 HAVANA gene 11869 14409 . + . gene_id "ENSG00000223972.5"; gene_type "transcribed_unprocessed_pseudogene"; gene_name "DDX11L1"; level 2; hgnc_id "HGNC:37102"; havana_gene "OTTHUMG00000000961.2";
chr1 HAVANA transcript 11869 14409 . + . gene_id "ENSG00000223972.5"; transcript_id "ENST00000456328.2"; gene_type "transcribed_unprocessed_pseudogene"; gene_name "DDX11L1"; transcript_type "processed_transcript"; transcript_name "DDX11L1-202"; level 2; transcript_support_level "1"; hgnc_id "HGNC:37102"; tag "basic"; havana_gene "OTTHUMG00000000961.2"; havana_transcript "OTTHUMT00000362751.1";
chr1 HAVANA exon 11869 12227 . + . gene_id "ENSG00000223972.5"; transcript_id "ENST00000456328.2"; gene_type "transcribed_unprocessed_pseudogene"; gene_name "DDX11L1"; transcript_type "processed_transcript"; transcript_name "DDX11L1-202"; exon_number 1; exon_id "ENSE00002234944.1"; level 2; transcript_support_level "1"; hgnc_id "HGNC:37102"; tag "basic"; havana_gene "OTTHUMG00000000961.2"; havana_transcript "OTTHUMT00000362751.1";
chr1 HAVANA exon 12613 12721 . + . gene_id "ENSG00000223972.5"; transcript_id "ENST00000456328.2"; gene_type "transcribed_unprocessed_pseudogene"; gene_name "DDX11L1"; transcript_type "processed_transcript"; transcript_name "DDX11L1-202"; exon_number 2; exon_id "ENSE00003582793.1"; level 2; transcript_support_level "1"; hgnc_id "HGNC:37102"; tag "basic"; havana_gene "OTTHUMG00000000961.2"; havana_transcript "OTTHUMT00000362751.1";
chr1 HAVANA exon 13221 14409 . + . gene_id "ENSG00000223972.5"; transcript_id "ENST00000456328.2"; gene_type "transcribed_unprocessed_pseudogene"; gene_name "DDX11L1"; transcript_type "processed_transcript"; transcript_name "DDX11L1-202"; exon_number 3; exon_id "ENSE00002312635.1"; level 2; transcript_support_level "1"; hgnc_id "HGNC:37102"; tag "basic"; havana_gene "OTTHUMG00000000961.2"; havana_transcript "OTTHUMT00000362751.1";
Searching for the word “gene” in a gtf file.
$ grep "gene" gencode.v39.annotation.gtf | head
chr1 HAVANA gene 11869 14409 . + . gene_id "ENSG00000223972.5"; gene_type "transcribed_unprocessed_pseudogene"; gene_name "DDX11L1"; level 2; hgnc_id "HGNC:37102"; havana_gene "OTTHUMG00000000961.2";
chr1 HAVANA transcript 11869 14409 . + . gene_id "ENSG00000223972.5"; transcript_id "ENST00000456328.2"; gene_type "transcribed_unprocessed_pseudogene"; gene_name "DDX11L1"; transcript_type "processed_transcript"; transcript_name "DDX11L1-202"; level 2; transcript_support_level "1"; hgnc_id "HGNC:37102"; tag "basic"; havana_gene "OTTHUMG00000000961.2"; havana_transcript "OTTHUMT00000362751.1";
chr1 HAVANA exon 11869 12227 . + . gene_id "ENSG00000223972.5"; transcript_id "ENST00000456328.2"; gene_type "transcribed_unprocessed_pseudogene"; gene_name "DDX11L1"; transcript_type "processed_transcript"; transcript_name "DDX11L1-202"; exon_number 1; exon_id "ENSE00002234944.1"; level 2; transcript_support_level "1"; hgnc_id "HGNC:37102"; tag "basic"; havana_gene "OTTHUMG00000000961.2"; havana_transcript "OTTHUMT00000362751.1";
chr1 HAVANA exon 12613 12721 . + . gene_id "ENSG00000223972.5"; transcript_id "ENST00000456328.2"; gene_type "transcribed_unprocessed_pseudogene"; gene_name "DDX11L1"; transcript_type "processed_transcript"; transcript_name "DDX11L1-202"; exon_number 2; exon_id "ENSE00003582793.1"; level 2; transcript_support_level "1"; hgnc_id "HGNC:37102"; tag "basic"; havana_gene "OTTHUMG00000000961.2"; havana_transcript "OTTHUMT00000362751.1";
chr1 HAVANA exon 13221 14409 . + . gene_id "ENSG00000223972.5"; transcript_id "ENST00000456328.2"; gene_type "transcribed_unprocessed_pseudogene"; gene_name "DDX11L1"; transcript_type "processed_transcript"; transcript_name "DDX11L1-202"; exon_number 3; exon_id "ENSE00002312635.1"; level 2; transcript_support_level "1"; hgnc_id "HGNC:37102"; tag "basic"; havana_gene "OTTHUMG00000000961.2"; havana_transcript "OTTHUMT00000362751.1";
chr1 HAVANA transcript 12010 13670 . + . gene_id "ENSG00000223972.5"; transcript_id "ENST00000450305.2"; gene_type "transcribed_unprocessed_pseudogene"; gene_name "DDX11L1"; transcript_type "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-201"; level 2; transcript_support_level "NA"; hgnc_id "HGNC:37102"; ont "PGO:0000005"; ont "PGO:0000019"; tag "basic"; tag "Ensembl_canonical"; havana_gene "OTTHUMG00000000961.2"; havana_transcript "OTTHUMT00000002844.2";
chr1 HAVANA exon 12010 12057 . + . gene_id "ENSG00000223972.5"; transcript_id "ENST00000450305.2"; gene_type "transcribed_unprocessed_pseudogene"; gene_name "DDX11L1"; transcript_type "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-201"; exon_number 1; exon_id "ENSE00001948541.1"; level 2; transcript_support_level "NA"; hgnc_id "HGNC:37102"; ont "PGO:0000005"; ont "PGO:0000019"; tag "basic"; tag "Ensembl_canonical"; havana_gene "OTTHUMG00000000961.2"; havana_transcript "OTTHUMT00000002844.2";
chr1 HAVANA exon 12179 12227 . + . gene_id "ENSG00000223972.5"; transcript_id "ENST00000450305.2"; gene_type "transcribed_unprocessed_pseudogene"; gene_name "DDX11L1"; transcript_type "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-201"; exon_number 2; exon_id "ENSE00001671638.2"; level 2; transcript_support_level "NA"; hgnc_id "HGNC:37102"; ont "PGO:0000005"; ont "PGO:0000019"; tag "basic"; tag "Ensembl_canonical"; havana_gene "OTTHUMG00000000961.2"; havana_transcript "OTTHUMT00000002844.2";
chr1 HAVANA exon 12613 12697 . + . gene_id "ENSG00000223972.5"; transcript_id "ENST00000450305.2"; gene_type "transcribed_unprocessed_pseudogene"; gene_name "DDX11L1"; transcript_type "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-201"; exon_number 3; exon_id "ENSE00001758273.2"; level 2; transcript_support_level "NA"; hgnc_id "HGNC:37102"; ont "PGO:0000005"; ont "PGO:0000019"; tag "basic"; tag "Ensembl_canonical"; havana_gene "OTTHUMG00000000961.2"; havana_transcript "OTTHUMT00000002844.2";
chr1 HAVANA exon 12975 13052 . + . gene_id "ENSG00000223972.5"; transcript_id "ENST00000450305.2"; gene_type "transcribed_unprocessed_pseudogene"; gene_name "DDX11L1"; transcript_type "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-201"; exon_number 4; exon_id "ENSE00001799933.2"; level 2; transcript_support_level "NA"; hgnc_id "HGNC:37102"; ont "PGO:0000005"; ont "PGO:0000019"; tag "basic"; tag "Ensembl_canonical"; havana_gene "OTTHUMG00000000961.2"; havana_transcript "OTTHUMT00000002844.2";
It occurs everywhere - even when it's not the type of interval we are looking for
We can search for something that looks just like the “word” gene with the -w
flag
$ grep -w "gene" gencode.v39.annotation.gtf | head
chr1 HAVANA gene 11869 14409 . + . gene_id "ENSG00000223972.5"; gene_type "transcribed_unprocessed_pseudogene"; gene_name "DDX11L1"; level 2; hgnc_id "HGNC:37102"; havana_gene "OTTHUMG00000000961.2";
chr1 HAVANA gene 14404 29570 . - . gene_id "ENSG00000227232.5"; gene_type "unprocessed_pseudogene"; gene_name "WASH7P"; level 2; hgnc_id "HGNC:38034"; havana_gene "OTTHUMG00000000958.1";
chr1 ENSEMBL gene 17369 17436 . - . gene_id "ENSG00000278267.1"; gene_type "miRNA"; gene_name "MIR6859-1"; level 3; hgnc_id "HGNC:50039";
chr1 HAVANA gene 29554 31109 . + . gene_id "ENSG00000243485.5"; gene_type "lncRNA"; gene_name "MIR1302-2HG"; level 2; hgnc_id "HGNC:52482"; tag "ncRNA_host"; havana_gene "OTTHUMG00000000959.2";
chr1 ENSEMBL gene 30366 30503 . + . gene_id "ENSG00000284332.1"; gene_type "miRNA"; gene_name "MIR1302-2"; level 3; hgnc_id "HGNC:35294";
chr1 HAVANA gene 34554 36081 . - . gene_id "ENSG00000237613.2"; gene_type "lncRNA"; gene_name "FAM138A"; level 2; hgnc_id "HGNC:32334"; havana_gene "OTTHUMG00000000960.1";
chr1 HAVANA gene 52473 53312 . + . gene_id "ENSG00000268020.3"; gene_type "unprocessed_pseudogene"; gene_name "OR4G4P"; level 2; hgnc_id "HGNC:14822"; havana_gene "OTTHUMG00000185779.1";
chr1 HAVANA gene 57598 64116 . + . gene_id "ENSG00000240361.2"; gene_type "transcribed_unprocessed_pseudogene"; gene_name "OR4G11P"; level 2; hgnc_id "HGNC:31276"; havana_gene "OTTHUMG00000001095.3";
chr1 HAVANA gene 65419 71585 . + . gene_id "ENSG00000186092.7"; gene_type "protein_coding"; gene_name "OR4F5"; level 2; hgnc_id "HGNC:14825"; havana_gene "OTTHUMG00000001094.4";
chr1 HAVANA gene 89295 133723 . - . gene_id "ENSG00000238009.6"; gene_type "lncRNA"; gene_name "ENSG00000238009"; level 2; tag "overlapping_locus"; havana_gene "OTTHUMG00000001096.2";
limiting the types of lines we get back.
-w, --word-regexp
Select only those lines containing matches
that form whole words. The test is that
the matching substring must either be at
the beginning of the line, or preceded by
a non-word constituent character.
Similarly, it must be either at the end of
the line or followed by a non-word
constituent character. Word-constituent
characters are letters, digits, and the
underscore. This option has no effect if
-x is also specified.
Same goes for when one is inverting a search.
$ grep -v "gene" gencode.v39.annotation.gtf
##description: evidence-based annotation of the human genome (GRCh38), version 39 (Ensembl 105)
##provider: GENCODE
##contact: gencode-help@ebi.ac.uk
##format: gtf
##date: 2021-09-02
Almost every line as “gene” somewhere in the line.
$ grep -v -w "gene" gencode.v39.annotation.gtf | head
##description: evidence-based annotation of the human genome (GRCh38), version 39 (Ensembl 105)
##provider: GENCODE
##contact: gencode-help@ebi.ac.uk
##format: gtf
##date: 2021-09-02
chr1 HAVANA transcript 11869 14409 . + . gene_id "ENSG00000223972.5"; transcript_id "ENST00000456328.2"; gene_type "transcribed_unprocessed_pseudogene"; gene_name "DDX11L1"; transcript_type "processed_transcript"; transcript_name "DDX11L1-202"; level 2; transcript_support_level "1"; hgnc_id "HGNC:37102"; tag "basic"; havana_gene "OTTHUMG00000000961.2"; havana_transcript "OTTHUMT00000362751.1";
chr1 HAVANA exon 11869 12227 . + . gene_id "ENSG00000223972.5"; transcript_id "ENST00000456328.2"; gene_type "transcribed_unprocessed_pseudogene"; gene_name "DDX11L1"; transcript_type "processed_transcript"; transcript_name "DDX11L1-202"; exon_number 1; exon_id "ENSE00002234944.1"; level 2; transcript_support_level "1"; hgnc_id "HGNC:37102"; tag "basic"; havana_gene "OTTHUMG00000000961.2"; havana_transcript "OTTHUMT00000362751.1";
chr1 HAVANA exon 12613 12721 . + . gene_id "ENSG00000223972.5"; transcript_id "ENST00000456328.2"; gene_type "transcribed_unprocessed_pseudogene"; gene_name "DDX11L1"; transcript_type "processed_transcript"; transcript_name "DDX11L1-202"; exon_number 2; exon_id "ENSE00003582793.1"; level 2; transcript_support_level "1"; hgnc_id "HGNC:37102"; tag "basic"; havana_gene "OTTHUMG00000000961.2"; havana_transcript "OTTHUMT00000362751.1";
chr1 HAVANA exon 13221 14409 . + . gene_id "ENSG00000223972.5"; transcript_id "ENST00000456328.2"; gene_type "transcribed_unprocessed_pseudogene"; gene_name "DDX11L1"; transcript_type "processed_transcript"; transcript_name "DDX11L1-202"; exon_number 3; exon_id "ENSE00002312635.1"; level 2; transcript_support_level "1"; hgnc_id "HGNC:37102"; tag "basic"; havana_gene "OTTHUMG00000000961.2"; havana_transcript "OTTHUMT00000362751.1";
chr1 HAVANA transcript 12010 13670 . + . gene_id "ENSG00000223972.5"; transcript_id "ENST00000450305.2"; gene_type "transcribed_unprocessed_pseudogene"; gene_name "DDX11L1"; transcript_type "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-201"; level 2; transcript_support_level "NA"; hgnc_id "HGNC:37102"; ont "PGO:0000005"; ont "PGO:0000019"; tag "basic"; tag "Ensembl_canonical"; havana_gene "OTTHUMG00000000961.2"; havana_transcript "OTTHUMT00000002844.2";
One must be careful that included in the results are not just areas where you have a substring.
-w
can be helpful here too
$ grep -w gene gencode.v39.annotation.gtf | grep "ATP5MF"
chr6 HAVANA gene 108907615 108907873 . - . gene_id "ENSG00000228834.1"; gene_type "processed_pseudogene"; gene_name "ATP5MFP2"; level 1; hgnc_id "HGNC:21540"; tag "pseudo_consens"; havana_gene "OTTHUMG00000015333.2";
chr7 HAVANA gene 99419749 99466197 . - . gene_id "ENSG00000248919.7"; gene_type "protein_coding"; gene_name "ATP5MF-PTCD1"; level 1; hgnc_id "HGNC:38844"; tag "overlapping_locus"; havana_gene "OTTHUMG00000160779.2";
chr7 HAVANA gene 99448475 99466186 . - . gene_id "ENSG00000241468.8"; gene_type "protein_coding"; gene_name "ATP5MF"; level 2; hgnc_id "HGNC:848"; tag "overlapping_locus"; havana_gene "OTTHUMG00000154609.7";
chr9 HAVANA gene 77040416 77040673 . + . gene_id "ENSG00000232851.3"; gene_type "processed_pseudogene"; gene_name "ATP5MFP3"; level 1; hgnc_id "HGNC:21286"; tag "pseudo_consens"; havana_gene "OTTHUMG00000020052.2";
chr12 HAVANA gene 6270168 6270425 . - . gene_id "ENSG00000256103.2"; gene_type "processed_pseudogene"; gene_name "ATP5MFP5"; level 1; hgnc_id "HGNC:33611"; tag "pseudo_consens"; havana_gene "OTTHUMG00000168354.1";
chr15 HAVANA gene 66414933 66415198 . - . gene_id "ENSG00000261102.2"; gene_type "processed_pseudogene"; gene_name "ATP5MFP6"; level 1; hgnc_id "HGNC:33612"; tag "pseudo_consens"; havana_gene "OTTHUMG00000172827.2";
chr17 HAVANA gene 64491523 64491789 . + . gene_id "ENSG00000256826.1"; gene_type "processed_pseudogene"; gene_name "ATP5MFP4"; level 1; hgnc_id "HGNC:32451"; tag "pseudo_consens"; havana_gene "OTTHUMG00000132312.1";
chr21 HAVANA gene 36388878 36389112 . - . gene_id "ENSG00000224421.1"; gene_type "processed_pseudogene"; gene_name "ATP5MFP1"; level 1; hgnc_id "HGNC:849"; tag "pseudo_consens"; havana_gene "OTTHUMG00000086613.1";
One must be careful that included in the results are not just areas where you have a substring.
-w
can be helpful here too … but not always.
$ grep -w gene gencode.v39.annotation.gtf | grep -w "ATP5MF"
chr7 HAVANA gene 99419749 99466197 . - . gene_id "ENSG00000248919.7"; gene_type "protein_coding"; gene_name "ATP5MF-PTCD1"; level 1; hgnc_id "HGNC:38844"; tag "overlapping_locus"; havana_gene "OTTHUMG00000160779.2";
chr7 HAVANA gene 99448475 99466186 . - . gene_id "ENSG00000241468.8"; gene_type "protein_coding"; gene_name "ATP5MF"; level 2; hgnc_id "HGNC:848"; tag "overlapping_locus"; havana_gene "OTTHUMG00000154609.7";
We can try to include the "
marks in our search to isolate just the string "ATP5MF"
rather than ATP5MF
$ grep -w gene gencode.v39.annotation.gtf | grep \"ATP5MF\"
chr7 HAVANA gene 99448475 99466186 . - . gene_id "ENSG00000241468.8"; gene_type "protein_coding"; gene_name "ATP5MF"; level 2; hgnc_id "HGNC:848"; tag "overlapping_locus"; havana_gene "OTTHUMG00000154609.7";
$ cat /usr/share/dict/words | egrep '^m...h$' | egrep -v 'r|a|i|s|e|u|l|c'
month
Starting at CANTO
cat /usr/share/dict/words | egrep '^.a...$' | egrep -v 'r|i|s|e|n|o' | grep c | grep t
batch
caput
catch
catty
hatch
latch
match
patch
tacky
watch
yacht
cut
is a command that extracts columns from filessort
is a command used to sort the contents of a file in a particular order.these commands both make use of columns of data.
By default, cut
expects columns in files to be separated by tabs. Like the GTF file above, and many other other common bioinformatics formats.
However, with the argument -d
we can specify a different delimiter. Some files like .csv
files can have thier columns separated by a comma (.csv
stands for comma separated values) and so we can cut columns from them with cut -d","
Here we can examine the chromosome and start coordinates from the GTF file.
The -f
argument allows us to chose the field or column we want to see
$ cut -f1,4 gencode.v39.annotation.gtf | head
##description: evidence-based annotation of the human genome (GRCh38), version 39 (Ensembl 105)
##provider: GENCODE
##contact: gencode-help@ebi.ac.uk
##format: gtf
##date: 2021-09-02
chr1 11869
chr1 11869
chr1 11869
chr1 12613
chr1 13221
By default, cut
expects columns in files to be separated by tabs. Like the GTF file above, and many other other common bioinformatics formats.
However, with the argument -d
we can specify a different delimiter. Some files like .csv
files can have thier columns separated by a comma (.csv
stands for comma separated values) and so we can cut columns from them with cut -d","
Here we can examine the chromosome and start coordinates from the GTF file.
The -f
argument allows us to chose the field or column we want to see
$ cut -f1,4 gencode.v39.annotation.gtf | grep -v # | head -4
chr1 11869
chr1 11869
chr1 11869
chr1 12613
By default, sort
sorts a text file by alpha/numeric order, across all columns.
It is able to, after sorting, showing only unique columns with the argument -u
.
$ cut -f1,4 gencode.v39.annotation.gtf | wc -l
3241007
$ cut -f1,4 gencode.v39.annotation.gtf | sort -u | wc -l
624652
sort
is also able to sort files based on specific columns with the -k
argument, and therein able to sort by specific methods.
general-numeric -g, human-numeric -h, month -M, numeric -n, random -R, version -V
Here we sort column 4 numerically.
sort -k4,4n gencode.v39.annotation.gtf | head -5
Here we sort column 4 reverse numerically.
sort -k4,4nr gencode.v39.annotation.gtf | head -5
Lets make a file of chromosome names to see how some of the sorts work:
Also just to place things on multiple lines, here we demonstrate that the \
can allow you continue on the next line without executing your command. This can be helpful for readability purposes.
$ cut -f1 ~/lecture5/gencode.v39.annotation.gtf | \
> grep -v "#" | \
> sort -u > ~/lecture5/chromosome_names.txt
$ cd ~/lecture5
$ shuf chromosome_names.txt | sort -n
chr1
chr10
chr11
chr12
chr13
chr14
chr15
chr16
chr17
chr18
chr19
chr2
chr20
chr21
chr22
chr3
chr4
chr5
chr6
chr7
chr8
chr9
chrX
chrY
shuf chromosome_names.txt | sort -V
chr1
chr2
chr3
chr4
chr5
chr6
chr7
chr8
chr9
chr10
chr11
chr12
chr13
chr14
chr15
chr16
chr17
chr18
chr19
chr20
chr21
chr22
chrX
chrY
GenomicRanges
bedtools allows one to intersect, merge, count, complement, and shuffle genomic intervals from multiple files in widely-used genomic file formats such as BAM, BED, GFF/GTF, VCF.
The GenomicRanges
package serves as the foundation for representing genomic locations within the Bioconductor project.
This package lays a foundation for genomic analysis by introducing three classes (GRanges
, GPos
, and GRangesList
), which are used to represent genomic ranges, genomic positions, and groups of genomic ranges.
HelloRanges
is a tool that will help us transfer our bedtools knowledge to R.
We will install it first.
BiocManager::install("HelloRanges")
library(HelloRanges)
bedtools is a command line tool with many subcommands to perform specific tasks.
bedtools is a powerful toolset for genome arithmetic.
Version: v2.30.0
About: developed in the quinlanlab.org and by many contributors worldwide.
Docs: http://bedtools.readthedocs.io/
Code: https://github.com/arq5x/bedtools2
Mail: https://groups.google.com/forum/#!forum/bedtools-discuss
Usage: bedtools <subcommand> [options]
The bedtools sub-commands include:
bedtools is a command line tool with many subcommands to perform specific tasks.
[ Genome arithmetic ]
intersect Find overlapping intervals in various ways.
window Find overlapping intervals within a window around an interval.
closest Find the closest, potentially non-overlapping interval.
coverage Compute the coverage over defined intervals.
map Apply a function to a column for each overlapping interval.
genomecov Compute the coverage over an entire genome.
merge Combine overlapping/nearby intervals into a single interval.
cluster Cluster (but don't merge) overlapping/nearby intervals.
complement Extract intervals _not_ represented by an interval file.
shift Adjust the position of intervals.
subtract Remove intervals based on overlaps b/w two files.
slop Adjust the size of intervals.
flank Create new intervals from the flanks of existing intervals.
sort Order the intervals in a file.
random Generate random intervals in a genome.
shuffle Randomly redistribute intervals in a genome.
sample Sample random records from file using reservoir sampling.
spacing Report the gap lengths between intervals in a file.
annotate Annotate coverage of features from multiple files.
bedtools is a command line tool with many subcommands to perform specific tasks.
each tool is called in the form bedtools <subcommand>
as follows:
$ bedtools intersect
Tool: bedtools intersect (aka intersectBed)
Version: v2.30.0
Summary: Report overlaps between two feature files.
Usage: bedtools intersect [OPTIONS] -a <bed/gff/vcf/bam> -b <bed/gff/vcf/bam>
Note: -b may be followed with multiple databases and/or
wildcard (*) character(s).
Options:
-wa Write the original entry in A for each overlap.
-wb Write the original entry in B for each overlap.
- Useful for knowing _what_ A overlaps. Restricted by -f and -r.
...
cpg.bed
- represents CpG islands in the human genomeexons.bed
- represents RefSeq exons from human genesgwas.bed
- represents human disease-associated SNPs that were identified in genome-wide association studieshesc.chromHmm.bed
- represents the predicted function (by chromHMM) of each interval in the genome of a human embryonic stem cell based upon ChIP-seq experiments from ENCODEI'll take a look at these quickly in IGV1 - an easy to use local genome browser
This is probably the command you will use the most often.
It compares 2 or more bed files (or bam, or vcf, or gtf) and identifies all the regions in the genome where the features overlap.
Want to know where one feature lies relative to another, this is your tool.
It compares 2 or more bed files (or bam, or vcf, or gtf) and identifies all the regions in the genome where the features overlap.
By default, intersect reports the intervals that represent overlaps between your two files. To demonstrate, let’s identify all of the CpG islands that overlap exons.
these are not the original cpg intervals, only the portion that overlaps with the exons
$ cp ~/data/*.bed ~/lecture5
$ cd ~/lecture5
$ bedtools intersect -a cpg.bed -b exons.bed | head -5
chr1 29320 29370 CpG:_116
chr1 135124 135563 CpG:_30
chr1 327790 328229 CpG:_29
chr1 327790 328229 CpG:_29
chr1 327790 328229 CpG:_29
$ █
By default, intersect reports the intervals that represent overlaps between your two files. To demonstrate, let’s identify all of the CpG islands that overlap exons.
these are not the original cpg intervals, only the portion that overlaps with the exons
setwd("~/lecture5")
code <- bedtools_intersect("-a cpg.bed -b exons.bed")
code
{
genome <- Seqinfo(genome = NA_character_)
gr_a <- import("cpg.bed", genome = genome)
gr_b <- import("exons.bed", genome = genome)
pairs <- findOverlapPairs(gr_a, gr_b, ignore.strand = TRUE)
ans <- pintersect(pairs, ignore.strand = TRUE)
ans
}
By default, intersect reports the intervals that represent overlaps between your two files. To demonstrate, let’s identify all of the CpG islands that overlap exons.
these are not the original cpg intervals, only the portion that overlaps with the exons
eval(code)
GRanges object with 45500 ranges and 2 metadata columns:
seqnames ranges strand | name hit
<Rle> <IRanges> <Rle> | <character> <logical>
[1] chr1 29321-29370 * | CpG:_116 TRUE
[2] chr1 135125-135563 * | CpG:_30 TRUE
[3] chr1 327791-328229 * | CpG:_29 TRUE
[4] chr1 327791-328229 * | CpG:_29 TRUE
[5] chr1 327791-328229 * | CpG:_29 TRUE
... ... ... ... . ... ...
[45496] chrY 59213949-59214117 * | CpG:_36 TRUE
[45497] chrY 59213949-59214117 * | CpG:_36 TRUE
[45498] chrY 59213949-59214117 * | CpG:_36 TRUE
[45499] chrY 59213949-59214117 * | CpG:_36 TRUE
[45500] chrY 59213949-59214117 * | CpG:_36 TRUE
-------
seqinfo: 69 sequences from an unspecified genome; no seqlengths
The -wa
(write A) and -wb
(write B) options allow one to see the original
records from the A and B files that overlapped. As such, instead of not only
showing you where the intersections occurred, it shows you what intersected.
bedtools intersect -a cpg.bed -b exons.bed -wa -wb | head -5
chr1 28735 29810 CpG:_116 chr1 29320 29370 NR_024540_exon_10_0_chr1_29321_r -
chr1 135124 135563 CpG:_30 chr1 134772 139696 NR_039983_exon_0_0_chr1_134773_r 0 -
chr1 327790 328229 CpG:_29 chr1 324438 328581 NR_028322_exon_2_0_chr1_324439_f 0 +
chr1 327790 328229 CpG:_29 chr1 324438 328581 NR_028325_exon_2_0_chr1_324439_f 0 +
chr1 327790 328229 CpG:_29 chr1 327035 328581 NR_028327_exon_3_0_chr1_327036_f 0 +
$ █
The -wa
(write A) and -wb
(write B) options allow one to see the original
records from the A and B files that overlapped. As such, instead of not only
showing you where the intersections occurred, it shows you what intersected.
code <- bedtools_intersect("-a cpg.bed -b exons.bed -wa -wb")
code
{
genome <- Seqinfo(genome = NA_character_)
gr_a <- import("cpg.bed", genome = genome)
gr_b <- import("exons.bed", genome = genome)
pairs <- findOverlapPairs(gr_a, gr_b, ignore.strand = TRUE)
ans <- pairs
ans
}
The -wa
(write A) and -wb
(write B) options allow one to see the original
records from the A and B files that overlapped. As such, instead of not only
showing you where the intersections occurred, it shows you what intersected.
eval(code)
Pairs object with 45500 pairs and 0 metadata columns:
first second
<GRanges> <GRanges>
[1] chr1:28736-29810 chr1:29321-29370:-
[2] chr1:135125-135563 chr1:134773-139696:-
[3] chr1:327791-328229 chr1:324439-328581:+
[4] chr1:327791-328229 chr1:324439-328581:+
[5] chr1:327791-328229 chr1:327036-328581:+
... ... ...
[45496] chrY:59213795-59214183 chrY:59213949-59214117:+
[45497] chrY:59213795-59214183 chrY:59213949-59214117:+
[45498] chrY:59213795-59214183 chrY:59213949-59214117:+
[45499] chrY:59213795-59214183 chrY:59213949-59214117:+
[45500] chrY:59213795-59214183 chrY:59213949-59214117:+
The -wo
(write overlap) option allows one to also report the number of base
pairs of overlap between the features that overlap between each of the files.
$ bedtools intersect -a cpg.bed -b exons.bed -wo | head -5
chr1 28735 29810 CpG:_116 chr1 29320 29370 NR_024540_exon_10_0_chr1_29321_r - 50
chr1 135124 135563 CpG:_30 chr1 134772 139696 NR_039983_exon_0_0_chr1_134773_r 0 439
chr1 327790 328229 CpG:_29 chr1 324438 328581 NR_028322_exon_2_0_chr1_324439_f 0 439
chr1 327790 328229 CpG:_29 chr1 324438 328581 NR_028325_exon_2_0_chr1_324439_f 0 439
chr1 327790 328229 CpG:_29 chr1 327035 328581 NR_028327_exon_3_0_chr1_327036_f 0 439
$ █
The -wo
(write overlap) option allows one to also report the number of base
pairs of overlap between the features that overlap between each of the files.
code <- bedtools_intersect("-a cpg.bed -b exons.bed -wo")
code
{
genome <- Seqinfo(genome = NA_character_)
gr_a <- import("cpg.bed", genome = genome)
gr_b <- import("exons.bed", genome = genome)
pairs <- findOverlapPairs(gr_a, gr_b, ignore.strand = TRUE)
ans <- pairs
mcols(ans)$overlap_width <- width(pintersect(ans, ignore.strand = TRUE))
ans
}
The -wo
(write overlap) option allows one to also report the number of base
pairs of overlap between the features that overlap between each of the files.
eval(code)
Pairs object with 45500 pairs and 1 metadata column:
first second | overlap_width
<GRanges> <GRanges> | <integer>
[1] chr1:28736-29810 chr1:29321-29370:- | 50
[2] chr1:135125-135563 chr1:134773-139696:- | 439
[3] chr1:327791-328229 chr1:324439-328581:+ | 439
[4] chr1:327791-328229 chr1:324439-328581:+ | 439
[5] chr1:327791-328229 chr1:327036-328581:+ | 439
... ... ... . ...
[45496] chrY:59213795-59214183 chrY:59213949-59214117:+ | 169
[45497] chrY:59213795-59214183 chrY:59213949-59214117:+ | 169
[45498] chrY:59213795-59214183 chrY:59213949-59214117:+ | 169
[45499] chrY:59213795-59214183 chrY:59213949-59214117:+ | 169
[45500] chrY:59213795-59214183 chrY:59213949-59214117:+ | 169
We can also count, for each feature in the “A” file, the number of overlapping
features in the “B” file. This is handled with the -c
option.
$ bedtools intersect -a cpg.bed -b exons.bed -c | head -5
chr1 28735 29810 CpG:_116 1
chr1 135124 135563 CpG:_30 1
chr1 327790 328229 CpG:_29 3
chr1 437151 438164 CpG:_84 0
chr1 449273 450544 CpG:_99 0
$ █
We can also count, for each feature in the “A” file, the number of overlapping
features in the “B” file. This is handled with the -c
option.
code <- bedtools_intersect("-a cpg.bed -b exons.bed -c")
code
{
genome <- Seqinfo(genome = NA_character_)
gr_a <- import("cpg.bed", genome = genome)
gr_b <- import("exons.bed", genome = genome)
ans <- gr_a
mcols(ans)$overlap_count <- countOverlaps(gr_a, gr_b, ignore.strand = TRUE)
ans
}
We can also count, for each feature in the “A” file, the number of overlapping
features in the “B” file. This is handled with the -c
option.
eval(code)
GRanges object with 28691 ranges and 2 metadata columns:
seqnames ranges strand | name overlap_count
<Rle> <IRanges> <Rle> | <character> <integer>
[1] chr1 28736-29810 * | CpG:_116 1
[2] chr1 135125-135563 * | CpG:_30 1
[3] chr1 327791-328229 * | CpG:_29 3
[4] chr1 437152-438164 * | CpG:_84 0
[5] chr1 449274-450544 * | CpG:_99 0
... ... ... ... . ... ...
[28687] chrY 27610116-27611088 * | CpG:_76 0
[28688] chrY 28555536-28555932 * | CpG:_32 0
[28689] chrY 28773316-28773544 * | CpG:_25 0
[28690] chrY 59213795-59214183 * | CpG:_36 5
[28691] chrY 59349267-59349574 * | CpG:_29 0
-------
seqinfo: 69 sequences from an unspecified genome; no seqlengths
remember grep -v
?!
Often we want to identify those features in our A file that do not overlap features in the B file.
$ bedtools intersect -a cpg.bed -b exons.bed -v | head -5
chr1 437151 438164 CpG:_84
chr1 449273 450544 CpG:_99
chr1 533219 534114 CpG:_94
chr1 544738 546649 CpG:_171
chr1 801975 802338 CpG:_24
$ █
remember grep -v
?!
Often we want to identify those features in our A file that do not overlap features in the B file.
code <- bedtools_intersect("-a cpg.bed -b exons.bed -v")
code
{
genome <- Seqinfo(genome = NA_character_)
gr_a <- import("cpg.bed", genome = genome)
gr_b <- import("exons.bed", genome = genome)
subsetByOverlaps(gr_a, gr_b, invert = TRUE, ignore.strand = TRUE)
}
remember grep -v
?!
Often we want to identify those features in our A file that do not overlap features in the B file.
eval(code)
GRanges object with 9846 ranges and 1 metadata column:
seqnames ranges strand | name
<Rle> <IRanges> <Rle> | <character>
[1] chr1 437152-438164 * | CpG:_84
[2] chr1 449274-450544 * | CpG:_99
[3] chr1 533220-534114 * | CpG:_94
[4] chr1 544739-546649 * | CpG:_171
[5] chr1 801976-802338 * | CpG:_24
... ... ... ... . ...
[9842] chrY 26351344-26352316 * | CpG:_76
[9843] chrY 27610116-27611088 * | CpG:_76
[9844] chrY 28555536-28555932 * | CpG:_32
[9845] chrY 28773316-28773544 * | CpG:_25
[9846] chrY 59349267-59349574 * | CpG:_29
-------
seqinfo: 69 sequences from an unspecified genome; no seqlengths
Recall that the default is to report overlaps between features in A and B so
long as at least one base pair of overlap exists. However, the -f
option
allows you to specify what fraction of each feature in A should be overlapped by
a feature in B before it is reported.
Let’s be more strict and require 50% of overlap.
$ bedtools intersect -a cpg.bed -b exons.bed -wo -f 0.50 | head -5
chr1 135124 135563 CpG:_30 chr1 134772 139696 NR_039983_exon_0_0_chr1_134773_r 0 439
chr1 327790 328229 CpG:_29 chr1 324438 328581 NR_028322_exon_2_0_chr1_324439_f 0 439
chr1 327790 328229 CpG:_29 chr1 324438 328581 NR_028325_exon_2_0_chr1_324439_f 0 439
chr1 327790 328229 CpG:_29 chr1 327035 328581 NR_028327_exon_3_0_chr1_327036_f 0 439
chr1 788863 789211 CpG:_28 chr1 788770 794826 NR_047519_exon_5_0_chr1_788771_f 0 348
$ █
Recall that the default is to report overlaps between features in A and B so
long as at least one base pair of overlap exists. However, the -f
option
allows you to specify what fraction of each feature in A should be overlapped by
a feature in B before it is reported.
Let’s be more strict and require 50% of overlap.
code <- bedtools_intersect("-a cpg.bed -b exons.bed -wo -f 0.50")
code
{
genome <- Seqinfo(genome = NA_character_)
gr_a <- import("cpg.bed", genome = genome)
gr_b <- import("exons.bed", genome = genome)
pairs <- findOverlapPairs(gr_a, gr_b, ignore.strand = TRUE)
olap <- pintersect(pairs, ignore.strand = TRUE)
keep <- width(olap)/width(first(pairs)) >= 0.5
pairs <- pairs[keep]
ans <- pairs
mcols(ans)$overlap_width <- width(olap)[keep]
ans
}
Recall that the default is to report overlaps between features in A and B so
long as at least one base pair of overlap exists. However, the -f
option
allows you to specify what fraction of each feature in A should be overlapped by
a feature in B before it is reported.
Let’s be more strict and require 50% of overlap.
eval(code)
Pairs object with 12669 pairs and 1 metadata column:
first second | overlap_width
<GRanges> <GRanges> | <integer>
[1] chr1:135125-135563 chr1:134773-139696:- | 439
[2] chr1:327791-328229 chr1:324439-328581:+ | 439
[3] chr1:327791-328229 chr1:324439-328581:+ | 439
[4] chr1:327791-328229 chr1:327036-328581:+ | 439
[5] chr1:788864-789211 chr1:788771-794826:+ | 348
... ... ... . ...
[12665] chrY:26979890-26980116 chrY:26979967-26980276:+ | 150
[12666] chrY:26979890-26980116 chrY:26979967-26980276:+ | 150
[12667] chrY:26979890-26980116 chrY:26979967-26980276:+ | 150
[12668] chrY:26979890-26980116 chrY:26979990-26980276:+ | 127
[12669] chrY:26979890-26980116 chrY:26979990-26980276:+ | 127
We can sort with the tools we already know (these files are all pre-sorted already)
$ sort -k1,1V -k2,2n gwas.bed > gwas.sorted.bed
$ █
bedtools is able to intersect an “A” file against one or more “B” files. This greatly simplifies analyses involving multiple datasets relevant to a given experiment. For example, let’s intersect exons with CpG islands, GWAS SNPs, and the ChromHMM annotations.
$ bedtools intersect -a exons.bed -b cpg.bed gwas.bed hesc.chromHmm.bed -sorted | head -5
chr1 11873 11937 NR_046018_exon_0_0_chr1_11874_f 0 +
chr1 11937 12137 NR_046018_exon_0_0_chr1_11874_f 0 +
chr1 12137 12227 NR_046018_exon_0_0_chr1_11874_f 0 +
chr1 12612 12721 NR_046018_exon_1_0_chr1_12613_f 0 +
chr1 13220 14137 NR_046018_exon_2_0_chr1_13221_f 0 +
$ █
Now by default, this isn’t incredibly informative as we can’t tell which of
the three “B” files yielded the intersection with each exon. However, if we use
the -wa
and -wb
options, we can see from which file number (following the order
of the files given on the command line) the intersection came. In this case,
the 7th column reflects this file number.
bedtools intersect -a exons.bed -b cpg.bed gwas.bed hesc.chromHmm.bed -sorted -wa -wb \
| head -10000 \
| tail -5
chr1 27632676 27635124 NM_015023_exon_15_0_chr1_27632677_f 0 + 3 chr1 27635013 27635413 7_Weak_Enhancer
chr1 27648635 27648882 NM_032125_exon_0_0_chr1_27648636_f 0 + 1 chr1 27648453 27649006 CpG:_63
chr1 27648635 27648882 NM_032125_exon_0_0_chr1_27648636_f 0 + 3 chr1 27648613 27649413 1_Active_Promoter
chr1 27648635 27648882 NR_037576_exon_0_0_chr1_27648636_f 0 + 1 chr1 27648453 27649006 CpG:_63
chr1 27648635 27648882 NR_037576_exon_0_0_chr1_27648636_f 0 + 3 chr1 27648613 27649413 1_Active_Promoter
$ █
Additionally, one can use file “labels” instead of file numbers to facilitate interpretation, especially when there are many files involved.
$ bedtools intersect -a exons.bed -b cpg.bed gwas.bed hesc.chromHmm.bed -sorted -wa -wb -names cpg gwas chromhmm \
| head -10000 \
| tail -5
chr1 27632676 27635124 NM_015023_exon_15_0_chr1_27632677_f 0 + chromhmm chr1 27635013 27635413 7_Weak_Enhancer
chr1 27648635 27648882 NM_032125_exon_0_0_chr1_27648636_f 0 + cpg chr1 27648453 27649006 CpG:_63
chr1 27648635 27648882 NM_032125_exon_0_0_chr1_27648636_f 0 + chromhmm chr1 27648613 27649413 1_Active_Promoter
chr1 27648635 27648882 NR_037576_exon_0_0_chr1_27648636_f 0 + cpg chr1 27648453 27649006 CpG:_63
chr1 27648635 27648882 NR_037576_exon_0_0_chr1_27648636_f 0 + chromhmm chr1 27648613 27649413 1_Active_Promoter
$ █
Additionally, one can use file “labels” instead of file numbers to facilitate interpretation, especially when there are many files involved.
code <- {
genome <- Seqinfo(genome = NA_character_)
gr_a <- import("exons.bed", genome = genome)
b <- c("cpg.bed", "gwas.bed", "hesc.chromHmm.bed")
names(b) <- c("cpg", "gwas", "chromhmm")
bl <- List(lapply(b, import, genome = genome))
gr_b <- stack(bl, "b")
pairs <- findOverlapPairs(gr_a, gr_b, ignore.strand = TRUE)
ans <- pairs
}
eval(code)
Pairs object with 541210 pairs and 0 metadata columns:
first second
<GRanges> <GRanges>
[1] chr1:11874-12227:+ chr1:11538-11937
[2] chr1:11874-12227:+ chr1:11938-12137
[3] chr1:11874-12227:+ chr1:12138-14137
[4] chr1:12613-12721:+ chr1:12138-14137
[5] chr1:13221-14409:+ chr1:12138-14137
... ... ...
[541206] chrY:59213949-59214117:+ chrY:59213795-59214183
[541207] chrY:59213949-59214117:+ chrY:59213795-59214183
[541208] chrY:59213949-59214117:+ chrY:59213795-59214183
[541209] chrY:59213949-59214117:+ chrY:59213795-59214183
[541210] chrY:59213949-59214117:+ chrY:59213795-59214183
Additionally, one can use file “labels” instead of file numbers to facilitate interpretation, especially when there are many files involved.
eval(code)
Pairs object with 541210 pairs and 0 metadata columns:
first second
<GRanges> <GRanges>
[1] chr1:11874-12227:+ chr1:11538-11937
[2] chr1:11874-12227:+ chr1:11938-12137
[3] chr1:11874-12227:+ chr1:12138-14137
[4] chr1:12613-12721:+ chr1:12138-14137
[5] chr1:13221-14409:+ chr1:12138-14137
... ... ...
[541206] chrY:59213949-59214117:+ chrY:59213795-59214183
[541207] chrY:59213949-59214117:+ chrY:59213795-59214183
[541208] chrY:59213949-59214117:+ chrY:59213795-59214183
[541209] chrY:59213949-59214117:+ chrY:59213795-59214183
[541210] chrY:59213949-59214117:+ chrY:59213795-59214183
Additionally, one can use file “labels” instead of file numbers to facilitate interpretation, especially when there are many files involved.
head(first(eval(code)))
GRanges object with 6 ranges and 2 metadata columns:
seqnames ranges strand | name score
<Rle> <IRanges> <Rle> | <character> <numeric>
[1] chr1 11874-12227 + | NR_046018_exon_0_0_c.. 0
[2] chr1 11874-12227 + | NR_046018_exon_0_0_c.. 0
[3] chr1 11874-12227 + | NR_046018_exon_0_0_c.. 0
[4] chr1 12613-12721 + | NR_046018_exon_1_0_c.. 0
[5] chr1 13221-14409 + | NR_046018_exon_2_0_c.. 0
[6] chr1 13221-14409 + | NR_046018_exon_2_0_c.. 0
-------
seqinfo: 49 sequences from an unspecified genome; no seqlengths
head(second(eval(code)))
GRanges object with 6 ranges and 2 metadata columns:
seqnames ranges strand | b name
<Rle> <IRanges> <Rle> | <Rle> <character>
[1] chr1 11538-11937 * | chromhmm 11_Weak_Txn
[2] chr1 11938-12137 * | chromhmm 14_Repetitive/CNV
[3] chr1 12138-14137 * | chromhmm 11_Weak_Txn
[4] chr1 12138-14137 * | chromhmm 11_Weak_Txn
[5] chr1 12138-14137 * | chromhmm 11_Weak_Txn
[6] chr1 14138-27537 * | chromhmm 9_Txn_Transition
-------
seqinfo: 70 sequences from an unspecified genome; no seqlengths
Many datasets of genomic features have many individual features that overlap one another (e.g. aligments from a ChiP seq experiment). It is often useful to just combine the overlapping into a single, contiguous interval.
The merge tool requires that the input file is sorted by chromosome, then by start position. This allows the merging algorithm to work very quickly without requiring any RAM.
If your files are unsorted, the merge tool will raise an error.
We can use bedtools sort to sort by a specific chromosome order - for example, exactly the one your colleague who aligned your data used with their reference genome.
$ cp ~/data/genome.txt ~/lecture5
$ bedtools sort -g genome.txt -i exons.bed > exons.sorted.bed
$ █
Merging results in a new set of intervals representing the merged set of intervals in the input. That is, if a base pair in the genome is covered by ten features, it will now only be represented once in the output file.
$ bedtools merge -i exons.bed | head -n 10
chr1 11873 12227
chr1 12612 12721
chr1 13220 14829
chr1 14969 15038
chr1 15795 15947
chr1 16606 16765
chr1 16857 17055
chr1 17232 17368
chr1 17605 17742
chr1 17914 18061
$ █
A more sophisticated approach would be to not only merge overlapping intervals, but also report the number of intervals that were integrated into the new, merged interval.
The -c
option allows one to specify a column or columns in the input that you wish to summarize
The -o
option defines the operation(s) that you wish to apply to each column listed for the -c option
$ bedtools merge -i exons.bed -c 1 -o count | head -n 10
chr1 11873 12227 1
chr1 12612 12721 1
chr1 13220 14829 2
chr1 14969 15038 1
chr1 15795 15947 1
chr1 16606 16765 1
chr1 16857 17055 1
chr1 17232 17368 1
chr1 17605 17742 1
chr1 17914 18061 1
$ █
-o Specify the operation that should be applied to -c.
Valid operations:
sum, min, max, absmin, absmax,
mean, median, mode, antimode
stdev, sstdev
collapse (i.e., print a delimited list (duplicates allowed)),
distinct (i.e., print a delimited list (NO duplicates allowed)),
distinct_sort_num (as distinct, sorted numerically, ascending),
distinct_sort_num_desc (as distinct, sorted numerically, desscending),
distinct_only (delimited list of only unique values),
count
count_distinct (i.e., a count of the unique values in the column),
first (i.e., just the first value in the column),
last (i.e., just the last value in the column),
Default: sum
Multiple operations can be specified in a comma-delimited list.
With the -d
(distance) option, one can also merge intervals that do not
overlap, yet are close to one another. For example, to merge features that are
no more than 1000bp apart, one would run:
$ bedtools merge -i exons.bed -d 1000 -c 1 -o count | head -10
chr1 11873 18366 12
chr1 24737 24891 1
chr1 29320 29370 1
chr1 34610 36081 6
chr1 69090 70008 1
chr1 134772 140566 3
chr1 323891 328581 10
chr1 367658 368597 3
chr1 621095 622034 3
chr1 661138 665731 3
$ █
Many times you want to keep track of the details of exactly which intervals were merged. One way to do this is to create a list of the names of each feature. We can do with with the collapse operation available via the -o
argument.
$ bedtools merge -i exons.bed -d 90 -c 1,4 -o count,collapse | head -20
chr1 11873 12227 1 NR_046018_exon_0_0_chr1_11874_f
chr1 12612 12721 1 NR_046018_exon_1_0_chr1_12613_f
chr1 13220 14829 2 NR_046018_exon_2_0_chr1_13221_f,NR_024540_exon_0_0_chr1_14362_r
chr1 14969 15038 1 NR_024540_exon_1_0_chr1_14970_r
chr1 15795 15947 1 NR_024540_exon_2_0_chr1_15796_r
chr1 16606 16765 1 NR_024540_exon_3_0_chr1_16607_r
chr1 16857 17055 1 NR_024540_exon_4_0_chr1_16858_r
chr1 17232 17368 1 NR_024540_exon_5_0_chr1_17233_r
chr1 17605 17742 1 NR_024540_exon_6_0_chr1_17606_r
chr1 17914 18061 1 NR_024540_exon_7_0_chr1_17915_r
$ █
Many times you want to keep track of the details of exactly which intervals were merged. One way to do this is to create a list of the names of each feature. We can do with with the collapse operation available via the -o
argument.
code <- bedtools_merge("-i exons.bed -d 90 -c 1,4 -o count,collapse")
code
{
genome <- Seqinfo(genome = NA_character_)
gr_a <- import("exons.bed", genome = genome)
ans <- reduce(gr_a, ignore.strand = TRUE, with.revmap = TRUE,
min.gapwidth = 91L)
mcols(ans) <- aggregate(gr_a, mcols(ans)$revmap, seqnames.count = lengths(seqnames),
name.collapse = unstrsplit(name, ","), drop = FALSE)
ans
}
Many times you want to keep track of the details of exactly which intervals were merged. One way to do this is to create a list of the names of each feature. We can do with with the collapse operation available via the -o
argument.
eval(code)
GRanges object with 221100 ranges and 3 metadata columns:
seqnames ranges strand | grouping
<Rle> <IRanges> <Rle> | <ManyToManyGrouping>
[1] chr1 11874-12227 * | 1
[2] chr1 12613-12721 * | 2
[3] chr1 13221-14829 * | 3,4
[4] chr1 14970-15038 * | 5
[5] chr1 15796-15947 * | 6
... ... ... ... . ...
[221096] chrY 59337091-59337236 * | 459744,459745
[221097] chrY 59337949-59338150 * | 459746,459747
[221098] chrY 59338754-59338859 * | 459748,459749
[221099] chrY 59340194-59340278 * | 459750
[221100] chrY 59342487-59343488 * | 459751,459752
seqnames.count name.collapse
<integer> <character>
[1] 1 NR_046018_exon_0_0_c..
[2] 1 NR_046018_exon_1_0_c..
[3] 2 NR_046018_exon_2_0_c..
[4] 1 NR_024540_exon_1_0_c..
[5] 1 NR_024540_exon_2_0_c..
... ... ...
[221096] 2 NM_002186_exon_4_0_c..
[221097] 2 NM_002186_exon_5_0_c..
[221098] 2 NM_002186_exon_6_0_c..
[221099] 1 NM_002186_exon_7_0_c..
[221100] 2 NM_002186_exon_8_0_c..
-------
seqinfo: 49 sequences from an unspecified genome; no seqlengths
We often want to know which intervals of the genome are NOT “covered” by intervals in a given feature file. For example, if you have a set of ChIP-seq peaks, you may also want to know which regions of the genome are not bound by the factor you assayed.
As an example, let’s find all of the non-exonic (i.e., intronic or intergenic) regions of the genome.
Here we see another use for the genome.txt
file.
$ bedtools complement -i exons.bed -g genome.txt > non-exonic.bed
$ head non-exonic.bed
chr1 0 11873
chr1 12227 12612
chr1 12721 13220
chr1 14829 14969
chr1 15038 15795
chr1 15947 16606
chr1 16765 16857
chr1 17055 17232
chr1 17368 17605
chr1 17742 17914
$ █
As an example, let’s find all of the non-exonic (i.e., intronic or intergenic) regions of the genome.
Here we see another use for the genome.txt
file. To use with the GRanges
tools, we have to rename it.
$ cp ~/lecture5/genome.txt ~/lecture5/hg38.genome
code <- bedtools_complement("-i exons.bed -g hg38.genome")
code
{
genome <- import("hg38.genome")
gr_a <- import("exons.bed", genome = genome)
ans <- setdiff(as(seqinfo(gr_a), "GRanges"), unstrand(gr_a))
ans
}
As an example, let’s find all of the non-exonic (i.e., intronic or intergenic) regions of the genome.
Here we see another use for the genome.txt
file. To use with the GRanges
tools, we have to rename it.
eval(code)
GRanges object with 229334 ranges and 0 metadata columns:
seqnames ranges strand
<Rle> <IRanges> <Rle>
[1] chr1 1-11873 *
[2] chr1 12228-12612 *
[3] chr1 12722-13220 *
[4] chr1 14830-14969 *
[5] chr1 15039-15795 *
... ... ... ...
[229330] chrY 59337237-59337948 *
[229331] chrY 59338151-59338753 *
[229332] chrY 59338860-59340193 *
[229333] chrY 59340279-59342486 *
[229334] chrY 59343489-59373566 *
-------
seqinfo: 93 sequences from hg38 genome
For many analyses, one wants to measure the genome wide coverage of a feature file. For example, we often want to know what fraction of the genome is covered by 1 feature, 2 features, 3 features, etc. This is frequently crucial when assessing the “uniformity” of coverage from whole-genome sequencing.
As an example, let’s produce a histogram of coverage of the exons throughout the genome.
$ bedtools genomecov -i exons.bed -g genome.txt > exon.histogram
$ less exon.histogram
chr1 0 241996316 249250621 0.970896
chr1 1 4276763 249250621 0.0171585
chr1 2 1475526 249250621 0.00591985
chr1 3 710135 249250621 0.00284908
chr1 4 388193 249250621 0.00155744
chr1 5 179651 249250621 0.000720765
chr1 6 91005 249250621 0.000365114
...
bedgraph1 is a format we didn't talk about, it allows display of continuous-valued data in track format. This display type is useful for probability scores, transcriptome data, and coverage! Using the -bg
option, one can also produce this output which represents the “depth” of feature coverage for each base pair in the genome.
$ bedtools genomecov -i exons.bed -g genome.txt -bg | head -10
chr1 11873 12227 1
chr1 12612 12721 1
chr1 13220 14361 1
chr1 14361 14409 2
chr1 14409 14829 1
chr1 14969 15038 1
chr1 15795 15947 1
chr1 16606 16765 1
chr1 16857 17055 1
chr1 17232 17368 1
$ █
bedgraph1 is a format we didn't talk about, it allows display of continuous-valued data in track format. This display type is useful for probability scores, transcriptome data, and coverage! Using the -bg
option, one can also produce this output which represents the “depth” of feature coverage for each base pair in the genome.
code <- bedtools_genomecov("-i exons.bed -g hg38.genome -bg")
code
{
genome <- import("hg38.genome")
gr_a <- import("exons.bed", genome = genome)
cov <- coverage(gr_a)
ans <- GRanges(cov)
ans <- subset(ans, score > 0)
ans
}
bedgraph1 is a format we didn't talk about, it allows display of continuous-valued data in track format. This display type is useful for probability scores, transcriptome data, and coverage! Using the -bg
option, one can also produce this output which represents the “depth” of feature coverage for each base pair in the genome.
eval(code)
GRanges object with 245860 ranges and 1 metadata column:
seqnames ranges strand | score
<Rle> <IRanges> <Rle> | <integer>
[1] chr1 11874-12227 * | 1
[2] chr1 12613-12721 * | 1
[3] chr1 13221-14361 * | 1
[4] chr1 14362-14409 * | 2
[5] chr1 14410-14829 * | 1
... ... ... ... . ...
[245856] chrY 59337120-59337236 * | 2
[245857] chrY 59337949-59338150 * | 2
[245858] chrY 59338754-59338859 * | 2
[245859] chrY 59340194-59340278 * | 1
[245860] chrY 59342487-59343488 * | 2
-------
seqinfo: 93 sequences from an unspecified genome
Let’s imagine you have a BED file of ChiP-seq peaks from two different experiments. You want to identify peaks that were observed in both experiments (requiring 50% reciprocal overlap) and for those peaks, you want to find to find the closest, non-overlapping gene. Such an analysis could be conducted with two, relatively simple bedtools commands.
intersect the peaks from both experiments.
-f
0.50 combined with -r
requires 50% reciprocal overlap between the
peaks from each experiment.
$ bedtools intersect -a exp1.bed -b exp2.bed -f 0.50 -r > both.bed
find the closest, non-overlapping gene for each interval where
both experiments had a peak
-io
ignores overlapping intervals and returns only the closest,
non-overlapping interval (in this case, genes)
$ bedtools closest -a both.bed -b genes.bed -io > both.nearest.genes.txt
These slides contain some extra information about the tools we learned about
There are certain meta-characters that are reserved in regex:
^: matches pattern at start of string
$: matches pattern at end of string
.: matches any character except new lines
[]: matches any of enclose characters
[^]: matches any characters *except* ones enclosed (note: is different from ^)
\: "escapes" meta-characters, allows literal matching
One can do some quite sophisticated searching with grep using regular expressions.
For these kinds of searches one can use “extended” grep or egrep
.
I'll use screenshots here to show what is being matched with color:
One can match a certain number of characters with {x,y}
. Here we are looking
for matches of any string of C’s and/or G’s that is six to twelve characters
long using the pattern [GC]{6,12}
.
+
The most prominent repetition modifierInstead of asking for a specific length of match, one can ask for at least one
match using the special symbol +
As an example we can search for a start codon ATG
followed by any number of
bases (at least one), and ending with a stop codon TGA
using the pattern ATG[ATGC]+TGA
We can also search for repetitive strings, where we want to search for the whole group of characters, not just one or two.
Here we search for CAG
repeats between six and twelve repeats long with the pattern (CAG){6,12}
. You'll note that we used parentheses instead of square brackets here.
AWK is a programming language that is specifically designed for quickly manipulating space delimited data. The name AWK comes from the initials of the inventors of the languguage at ATT Bell Labs: Alfred Aho, Peter Weinberger, and Brian Kernighan
An awk
program tends to have the structure of
condition { action }
condition { action }
...
We will only be dealing with simple conditions here though.
cpg.bed
Optional Fields:
Name, Score, Strand, thickStart, thickEnd, itemRgb, blockCount, blockSizes, blockStarts
cpg.bed
$ head cpg.bed
chr1 28735 29810 CpG:_116
chr1 135124 135563 CpG:_30
chr1 327790 328229 CpG:_29
chr1 437151 438164 CpG:_84
chr1 449273 450544 CpG:_99
chr1 533219 534114 CpG:_94
chr1 544738 546649 CpG:_171
chr1 713984 714547 CpG:_60
chr1 762416 763445 CpG:_115
chr1 788863 789211 CpG:_28
$ █
condition { action }
The default action in awk is to print the line, so we take advantage of that frequently for filtering a big file.
columns are identifed by number
↓
awk '$1 == "chr1"' cpg.bed
↑ ↑
single quotes indicate the start and end of the program.
Here we are only printing records from cpg.bed
that are for chr1
In this case we are searching for lines where the end coordinate is less than the start coordinate.
$ awk '$3 < $2' cpg.bed
$
This returns no lines on a well formed bed file, because the start should come before the end.
NR
is a special variable in awk that stands for record number.
$ awk 'NR == 100' cpg.bed
chr1 1417285 1417753 CpG:_42
$ █
The above command prints the 100th line in the file.
It's possible to have multiple conditions at once too!
in awk, like many languages, the logical AND operator is &&
Here we return lines 100 - 200
$ awk 'NR >= 100 && NR <= 200' cpg.bed
chr1 1417285 1417753 CpG:_42
chr1 1420226 1420684 CpG:_34
chr1 1444588 1444849 CpG:_19
chr1 1446878 1448205 CpG:_151
chr1 1452701 1453199 CpG:_40
chr1 1455302 1455892 CpG:_48
chr1 1456829 1457074 CpG:_18
chr1 1457954 1459029 CpG:_77
...
Going further we can add in a logical OR
operator and group the sub-statements too
$ awk '(NR >= 100 && NR <= 200) || ($1 == "chr18)'
chr1 1417285 1417753 CpG:_42
chr1 1420226 1420684 CpG:_34
chr1 1444588 1444849 CpG:_19
chr1 1446878 1448205 CpG:_151
chr1 1452701 1453199 CpG:_40
chr1 1455302 1455892 CpG:_48
chr1 1456829 1457074 CpG:_18
chr1 1457954 1459029 CpG:_77
...
condition { action }
Rather than just manipulating the condition in which to print lines, we can also manipulate the output.
We are using the action between curly braces to print the BED record and the length of that interval
$0 indicates to print the whole line
↓
$ awk '{print $0, $3-$2}' cpg.bed
chr1 28735 29810 CpG:_116 1075
chr1 135124 135563 CpG:_30 439
chr1 327790 328229 CpG:_29 439
...
By default awk uses a space to separate columns. Most genomics tasks prefer tabs, and keeping them all consistent is better than mixing them.
This also introduces another special variable for AWK, OFS
which is the Output field separator.
$ awk -vOFS='\t' '{print $0, $3-$2}' cpg.bed
chr1 28735 29810 CpG:_116 1075
chr1 135124 135563 CpG:_30 439
chr1 327790 328229 CpG:_29 439
...
When one sets the OFS
variable, it only changes for rows that are altered. The annoying sideffect of this is that a command like.
awk -vOFS='\t' '{print $0}'
does not change the delimiters between all columns in the file like you might expect - since nothing is being changed.
A quick trick to change all the column delimiters at once, is just to reassign a column to itself.
awk -vOFS='\t' '$1=$1'
This alters every row, and replaces all the column delimiters with tabs
We can use awk to print columns in any order, whereas cut
prints them only in the original order.
$ cut -f4,1 cpg.bed
chr1 CpG:_116
chr1 CpG:_30
chr1 CpG:_29
...
With awk we print in arbitrary order, depending on how we list the columns in the print statement.
$ awk -vOFS='\t' '{print $4, $1}'
CpG:_116 chr1
CpG:_30 chr1
CpG:_29 chr1
...
One more helpful built in variable we have in awk is NF
. This represents the number of fields/columns are detected for each line. By default, these are just white-space delimited.
$ awk '{print NF}' cpg.bed
4
4
4
...
Sometimes when ones computation get's a little more complex, its nice to be able to assign your own variables, and not just use the ones built into awk.
This is a simple example that still just prints the length of the element after printing the line.
len is a variable that is assigned the output of $3-$2
↓
$ awk -vOFS='\t' '{len=($3-$2); print $0, len}' cpg.bed
chr1 28735 29810 CpG:_116 1075
chr1 135124 135563 CpG:_30 439
chr1 327790 328229 CpG:_29 439
We can compute the total number of base pairs represented by the CpG islands in two parts.
$ awk '{tot_len += $3-$2}END{print tot_len}' cpg.bed
21842742
$ █
First, we start with a variable tot_len
that starts at 0 but increases by the length of each CpG island as awk proceeds down the file.
We then have an END
statement that indicates that that the following part occurs after all the line by line processing is finished.
Second, we print the contents the tot_len
variable
We can use one of the built in variables in our calculation too.
Here we calculate the average number of base pairs represented by a CpG island.
$ awk '{tot_len += $3-$2}END{print tot_len/NR}' cpg.bed
761.31
$ █
We can even - using arrays in AWK - compute something per unique value in a column.
Here we calculate the number of base pairs per chromatin annotation across the file. This is advanced usage, but can be useful to add to ones toolbox.
array called "a" indexed by the values in column 4
↓
awk '{a[$4] += ($3-$2)} END {for (i in a) print i, a[i]}' hesc.chromHmm.bed | sort -k2,2nr
↑
we increment the value for each index by the length of each element of that index
We can even - using arrays in AWK - compute something per unique value in a column.
Here we calculate the number of base pairs per chromatin annotation across the file. This is advanced usage, but can be useful to add to ones toolbox.
$ awk '{a[$4] += ($3-$2)} END {for (i in a) print i, a[i]}' hesc.chromHmm.bed | sort -k2,2nr
13_Heterochrom/lo 1992618522
11_Weak_Txn 503587684
10_Txn_Elongation 82134508
7_Weak_Enhancer 66789380
12_Repressed 38190271
6_Weak_Enhancer 35705628
9_Txn_Transition 25674539
8_Insulator 22467670
2_Weak_Promoter 18737021
3_Poised_Promoter 18724570
1_Active_Promoter 9908594
5_Strong_Enhancer 7139201
14_Repetitive/CNV 4079101
4_Strong_Enhancer 2648615
15_Repetitive/CNV 2342560
$ █